This website uses cookies to ensure you get the best experience on our website. Learn more

Rolling 1000 Dice???? | 1000 पासे फेकने पर कितने 6 आएंगे? Real Life Test

x
  • How Does COVID-19 Testing Actually Work?

    42:37

    Sars-Cov-2, the virus that causes Covid-19 is easily the most defining feature of 2020. In the last 8 months the world has changed radically and there have been plenty of fumbles as countries struggle to deal with the chaos. One of the most important issues has been testing for the virus. In this video, I aim to demystify how that testing actually works down to the chemical level and show exactly how it's done. We'll be covering the viruses anatomy, as well as three types of test: PCR, LAMP and Antibody.

    Earlier videos:
    PCR -
    Gel Electrophoresis -
    ___________________________________________________________________
    Try tab for a cause today:

    ___________________________________________________________________
    00:00 - Introduction
    04:00 - Virus Anatomy Overview
    09:45 - PCR Overview
    13:30 - Performing PCR
    20:37 - Testing at Scale and Robots (Opentrons)
    23:30 - LAMP overview
    27:50 - Performing LAMP (Biofoundry)
    30:30 - Pros/Cons of Genetic Tests
    31:30 - Antibody Overview
    32:50 - Performing Antibody Test
    34:00 - How Antibody Tests Work
    38:00 - Summary
    ___________________________________________________________________
    Support the show and future projects:

    Patreon:

    Ko-Fi:

    Become a member:
    _________________________________________________________________
    My Social Media Pages:

    Instagram:

    Facebook:

    Twitter:

    Website:
    ______________________________________________________________________
    More resources, and citations:

    Kurzgesagt Covid Overview:
    A great writeup about the virus's anatomy:
    JOGL:
    Biofoundry:
    Student Outbreak:
    Student Outbreak 2:
    Strokes In heathy people:
    Organ Damage:
    Aptamer Tests:
    Variations in Test Accuracy:
    Faulty probes:
    Contaminated Swabs:
    False positives FDA:
    E protein structure:
    MERS fact sheet:
    Incidence of thromboembolism:
    Stroke study:
    Stroke 2:
    Cardiac infection:
    Asymptomatic infection rate:
    Asymptomatic infection study:
    Organ damage in asymptomatic pateints:
    Wisconsin LAMP trial:
    Healthy people stroke:
    LAMP Assay design:
    Mutation geneology:
    Cardiac outcomes:
    False negative rate:
    ACE2 distribution:
    Long Haulers article:
    Long haulers Video:
    Complete protein models:
    Antibody test:
    _________________________________________________________________________________
    Right after this video went up, one of my awesome friends Sebastian designed new primers which are much much better than the CDC or other primers used in this video. Here are their sequences for those interested and if you'd like, check out Sebastian's work here:
    SpikeF - AGGAATTTTTATGAACCACAAATCA
    MembraneR - CGGTGATCCAATTTATTCTGTAAAC
    NucleoF - AAATGAAAGATCTCAGTCCAAGATG
    NucleoR - ACAGTTTGCTGTTTCTTCTGTCTCT

    Original Primers:
    N1F - GACCCCAAAATCAGCGAAAT
    N2F - ttacaaacattggccgcaaa
    N3F - GGGAGCCTTGAATACACCAAAA
    N2R - GCGCGACATTCCGAAGAA
    N2-LF - gggggcaaattgtgcaatttg
    N2-B3 - gacttgatctttgaaatttggatct
    N2-F3 - accaggaactaatcagacaag

  • x
  • Cheetahs: Fastest Hunters in Africa | Free Documentary Nature

    52:06

    Cheetahs: Fastest Hunters in Africa | Wildlife Documentary

    If cheetahs were race cars - definitely Formula One. Cheetahs are the high-speed hunters of the Savannah. Even though they’re super speedy, and there are few animals they can’t catch, cheetahs rarely attempt to take on larger prey than gazelles or smallish antelopes. But on occasion, the predatory cats reveal a surprisingly different side. In the Northern Serengeti, a group of male cheetahs was discovered and turned all we know about them upside down. Males are usually loners or live in small groups, but here we have five male cats hunting together as one. It is actually the largest alliance of cheetahs ever seen. This film has many stories to tell about the fastest cats in the wild.
    ▬▬▬▬▬▬▬▬▬

    Subscribe Free Documentary - Nature Channel for free:
    Facebook:
    Twitter:

    ▬▬▬▬▬▬▬▬▬
    #FreeDocumentaryNature #Documentary #Cheetah
    ▬▬▬▬▬▬▬▬▬

    Free Documentary is dedicated to bring high-class documentaries to you on youtube for free. With the latest camera equipment used by well-known filmmakers working for famous production studios. You will see fascinating shots from the deep seas and up in the air, capturing great stories and pictures from everything our beautiful and interesting planet has to offer.

    Enjoy stories about nature, wildlife, culture, people, history and more to come.

Shares

x

Check Also

Menu